ID: 1152350182_1152350187

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1152350182 1152350187
Species Human (GRCh38) Human (GRCh38)
Location 17:79779746-79779768 17:79779796-79779818
Sequence CCTTTTCTGCTGAGTAATTTGCA CAGGTTTGCCACAGTGACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 479} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!