ID: 1152375923_1152375934

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1152375923 1152375934
Species Human (GRCh38) Human (GRCh38)
Location 17:79919028-79919050 17:79919066-79919088
Sequence CCAGCATGTGGCTCCCTGGCTTC GGGTCCCCTGTGGCAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 250} {0: 1, 1: 1, 2: 3, 3: 33, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!