ID: 1152382319_1152382329

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152382319 1152382329
Species Human (GRCh38) Human (GRCh38)
Location 17:79948517-79948539 17:79948550-79948572
Sequence CCTCTGGCTCTGTGTGGCTGTAT CCACCCACGGGGAGATGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 340} {0: 1, 1: 0, 2: 1, 3: 8, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!