ID: 1152388205_1152388214

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152388205 1152388214
Species Human (GRCh38) Human (GRCh38)
Location 17:79987681-79987703 17:79987703-79987725
Sequence CCAGCCACAGCCTCCCTCTGCGG GGCAGAACCCTGGGTGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 737} {0: 1, 1: 0, 2: 2, 3: 44, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!