ID: 1152397098_1152397101

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1152397098 1152397101
Species Human (GRCh38) Human (GRCh38)
Location 17:80040141-80040163 17:80040158-80040180
Sequence CCAGCAAGAGGCCACCGGTCCAC GTCCACCAGAATCCAGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73} {0: 1, 1: 0, 2: 0, 3: 25, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!