ID: 1152397129_1152397136

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1152397129 1152397136
Species Human (GRCh38) Human (GRCh38)
Location 17:80040253-80040275 17:80040298-80040320
Sequence CCAGCAGTGGGCAGATTGGTGAG CCAGTGTCGCACGGCCCACGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 132} {0: 1, 1: 0, 2: 1, 3: 0, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!