ID: 1152404779_1152404795

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1152404779 1152404795
Species Human (GRCh38) Human (GRCh38)
Location 17:80091000-80091022 17:80091040-80091062
Sequence CCCTGTCCCTTCTTCCCCGGCTC CGACTGTGTCAGCCGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 488} {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!