ID: 1152407277_1152407287

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152407277 1152407287
Species Human (GRCh38) Human (GRCh38)
Location 17:80104883-80104905 17:80104920-80104942
Sequence CCAGGAACAGTGCGAGGCCCGCG CCTGCAAAGCAGGGGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84} {0: 1, 1: 1, 2: 6, 3: 47, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!