ID: 1152409965_1152409979

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152409965 1152409979
Species Human (GRCh38) Human (GRCh38)
Location 17:80118229-80118251 17:80118254-80118276
Sequence CCCATGGCCCTGGCTGTGGCCCT CCAAGGGTGGGGAGGCCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 384} {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!