ID: 1152419379_1152419383

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1152419379 1152419383
Species Human (GRCh38) Human (GRCh38)
Location 17:80183899-80183921 17:80183926-80183948
Sequence CCATCTGCCCACAGGTCTCATGG ATCCAAGCTGACCGAGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 252} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!