ID: 1152420585_1152420590

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1152420585 1152420590
Species Human (GRCh38) Human (GRCh38)
Location 17:80190865-80190887 17:80190893-80190915
Sequence CCCAGGTGTGCGAGCTGCAGAAG AGACCAGGTACCTGAGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 144} {0: 1, 1: 0, 2: 1, 3: 21, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!