ID: 1152424273_1152424283

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152424273 1152424283
Species Human (GRCh38) Human (GRCh38)
Location 17:80210496-80210518 17:80210533-80210555
Sequence CCTCCAGGACGCCGTCGGGGGCG GTGGGTCTCCCACTGCCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85} {0: 1, 1: 2, 2: 0, 3: 10, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!