ID: 1152448251_1152448263

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1152448251 1152448263
Species Human (GRCh38) Human (GRCh38)
Location 17:80359127-80359149 17:80359176-80359198
Sequence CCCCCTTCCGCAGGCCTGATGAT GCTTCCACTTCAGCTTTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119} {0: 1, 1: 0, 2: 1, 3: 22, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!