ID: 1152450805_1152450811

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1152450805 1152450811
Species Human (GRCh38) Human (GRCh38)
Location 17:80378374-80378396 17:80378403-80378425
Sequence CCTAGAGCCCTCCATACACAGTA CTTGCTGAGCAAGAGGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125} {0: 1, 1: 0, 2: 1, 3: 24, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!