ID: 1152456831_1152456841

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1152456831 1152456841
Species Human (GRCh38) Human (GRCh38)
Location 17:80421639-80421661 17:80421686-80421708
Sequence CCAATTTGCAGGGTACATCTTCT CTCATAGGTGAGGCAGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 220} {0: 1, 1: 0, 2: 0, 3: 24, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!