ID: 1152459180_1152459187

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1152459180 1152459187
Species Human (GRCh38) Human (GRCh38)
Location 17:80432381-80432403 17:80432395-80432417
Sequence CCTGTGGAGTCCTGTCTGGATGG TCTGGATGGGAGGGAGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187} {0: 1, 1: 1, 2: 3, 3: 51, 4: 540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!