ID: 1152459180_1152459188

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1152459180 1152459188
Species Human (GRCh38) Human (GRCh38)
Location 17:80432381-80432403 17:80432401-80432423
Sequence CCTGTGGAGTCCTGTCTGGATGG TGGGAGGGAGAGCAGGGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187} {0: 1, 1: 0, 2: 7, 3: 97, 4: 965}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!