ID: 1152466734_1152466739

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1152466734 1152466739
Species Human (GRCh38) Human (GRCh38)
Location 17:80470901-80470923 17:80470927-80470949
Sequence CCGGACAGAGCCTTGGTGCTGCA GGCCAGGTTGTACACCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160} {0: 1, 1: 0, 2: 2, 3: 4, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!