ID: 1152467808_1152467827

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1152467808 1152467827
Species Human (GRCh38) Human (GRCh38)
Location 17:80475796-80475818 17:80475849-80475871
Sequence CCCCTCTGGGCGACTGCGGGGGC CCGCGGGGCCTCGCAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117} {0: 1, 1: 0, 2: 5, 3: 26, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!