ID: 1152467810_1152467827

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152467810 1152467827
Species Human (GRCh38) Human (GRCh38)
Location 17:80475798-80475820 17:80475849-80475871
Sequence CCTCTGGGCGACTGCGGGGGCGG CCGCGGGGCCTCGCAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126} {0: 1, 1: 0, 2: 5, 3: 26, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!