ID: 1152480977_1152480980

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152480977 1152480980
Species Human (GRCh38) Human (GRCh38)
Location 17:80552364-80552386 17:80552389-80552411
Sequence CCCTTCTCGTCGTTCATACTTAG TCTAGGTCCCTTCCTCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44} {0: 1, 1: 0, 2: 3, 3: 19, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!