ID: 1152520103_1152520110

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152520103 1152520110
Species Human (GRCh38) Human (GRCh38)
Location 17:80850791-80850813 17:80850816-80850838
Sequence CCGCCCTGCTCATCAGGTGCCCG GCACCCTGGCCTGCAGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175} {0: 1, 1: 0, 2: 5, 3: 48, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!