ID: 1152521765_1152521776

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1152521765 1152521776
Species Human (GRCh38) Human (GRCh38)
Location 17:80860533-80860555 17:80860566-80860588
Sequence CCCCAAGTCCTCACGTACTACTT GCTGAAGTCAGGGGGCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 93} {0: 1, 1: 0, 2: 8, 3: 44, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!