ID: 1152521765_1152521778

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152521765 1152521778
Species Human (GRCh38) Human (GRCh38)
Location 17:80860533-80860555 17:80860584-80860606
Sequence CCCCAAGTCCTCACGTACTACTT TGGGGAGGCTGCTGCCGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 93} {0: 1, 1: 0, 2: 1, 3: 25, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!