ID: 1152526212_1152526220

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1152526212 1152526220
Species Human (GRCh38) Human (GRCh38)
Location 17:80889650-80889672 17:80889695-80889717
Sequence CCTAAAGAAGGCCAGTGCGTGTG TCCATTCAGGAAGGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130} {0: 1, 1: 0, 2: 3, 3: 25, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!