ID: 1152531708_1152531717

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1152531708 1152531717
Species Human (GRCh38) Human (GRCh38)
Location 17:80922838-80922860 17:80922859-80922881
Sequence CCCGCTCAGCCTGCAGGTCCGTG TGGTGGTGACCGGGGCCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 686} {0: 1, 1: 0, 2: 1, 3: 16, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!