ID: 1152531708_1152531718

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152531708 1152531718
Species Human (GRCh38) Human (GRCh38)
Location 17:80922838-80922860 17:80922860-80922882
Sequence CCCGCTCAGCCTGCAGGTCCGTG GGTGGTGACCGGGGCCCCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 686} {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!