ID: 1152532545_1152532553

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1152532545 1152532553
Species Human (GRCh38) Human (GRCh38)
Location 17:80927826-80927848 17:80927865-80927887
Sequence CCGCCTGCCCTCATCTCCTCCAT TCCCGCCCGCACGGAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 108, 4: 941} {0: 1, 1: 0, 2: 0, 3: 9, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!