ID: 1152532547_1152532556

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152532547 1152532556
Species Human (GRCh38) Human (GRCh38)
Location 17:80927833-80927855 17:80927868-80927890
Sequence CCCTCATCTCCTCCATTTGCACA CGCCCGCACGGAGGAGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 372} {0: 1, 1: 0, 2: 0, 3: 18, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!