ID: 1152532548_1152532551

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152532548 1152532551
Species Human (GRCh38) Human (GRCh38)
Location 17:80927834-80927856 17:80927856-80927878
Sequence CCTCATCTCCTCCATTTGCACAT TCTGAGAATTCCCGCCCGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 385} {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!