ID: 1152543511_1152543521

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1152543511 1152543521
Species Human (GRCh38) Human (GRCh38)
Location 17:80989250-80989272 17:80989284-80989306
Sequence CCCAGAGGCCCGCAGGTCACGAA AGACCCTCCATGGCCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 53} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!