ID: 1152548929_1152548938

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1152548929 1152548938
Species Human (GRCh38) Human (GRCh38)
Location 17:81019666-81019688 17:81019710-81019732
Sequence CCCCACTCCGGGGAGGCGGGAGC TGCCCAGCGGGGCCAGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164} {0: 1, 1: 0, 2: 3, 3: 27, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!