ID: 1152551331_1152551346

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1152551331 1152551346
Species Human (GRCh38) Human (GRCh38)
Location 17:81031900-81031922 17:81031950-81031972
Sequence CCGCTCGGCGCCCTGTGTGCATG AGACCCCTGGCTCAGAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93} {0: 1, 1: 0, 2: 4, 3: 45, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!