ID: 1152551988_1152552008

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1152551988 1152552008
Species Human (GRCh38) Human (GRCh38)
Location 17:81034744-81034766 17:81034795-81034817
Sequence CCCCGCACCTTCTGCTCCTTCTT CCCCCAGCCCGGCTGTTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 481} {0: 1, 1: 0, 2: 4, 3: 37, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!