ID: 1152551993_1152552010

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1152551993 1152552010
Species Human (GRCh38) Human (GRCh38)
Location 17:81034767-81034789 17:81034796-81034818
Sequence CCTGCGCCACCCCGCCCCCGCCT CCCCAGCCCGGCTGTTGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 189, 4: 1474} {0: 1, 1: 1, 2: 2, 3: 36, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!