ID: 1152551997_1152552019

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1152551997 1152552019
Species Human (GRCh38) Human (GRCh38)
Location 17:81034778-81034800 17:81034818-81034840
Sequence CCGCCCCCGCCTCCCCGCCCCCA GCCCCCTCAGGCTGCTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 83, 3: 854, 4: 5861} {0: 1, 1: 0, 2: 5, 3: 40, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!