ID: 1152552260_1152552280

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1152552260 1152552280
Species Human (GRCh38) Human (GRCh38)
Location 17:81035560-81035582 17:81035612-81035634
Sequence CCCAGCCCCAGGCCCGGGGAGCA CCGCGCGCTCGCCTTGGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 427} {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!