ID: 1152555325_1152555329

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1152555325 1152555329
Species Human (GRCh38) Human (GRCh38)
Location 17:81050102-81050124 17:81050116-81050138
Sequence CCTACAGTGCGTGCCTGAGGCAG CTGAGGCAGGGCTCCACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 203} {0: 1, 1: 0, 2: 1, 3: 28, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!