ID: 1152559462_1152559472

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152559462 1152559472
Species Human (GRCh38) Human (GRCh38)
Location 17:81070738-81070760 17:81070763-81070785
Sequence CCACCCCGGGTGGATGGCCGCTG CCGGGAGCCCCCGTCTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 82} {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!