ID: 1152560733_1152560737

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1152560733 1152560737
Species Human (GRCh38) Human (GRCh38)
Location 17:81077664-81077686 17:81077677-81077699
Sequence CCGCCCGTCCTGAGGCTGGTGGT GGCTGGTGGTGCTGAGTATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 142} {0: 1, 1: 1, 2: 1, 3: 35, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!