ID: 1152563316_1152563322

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1152563316 1152563322
Species Human (GRCh38) Human (GRCh38)
Location 17:81089394-81089416 17:81089408-81089430
Sequence CCTGCCTCAGTGCTGTGGTCCAC GTGGTCCACGGTCTGGGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 227} {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!