ID: 1152565005_1152565016

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1152565005 1152565016
Species Human (GRCh38) Human (GRCh38)
Location 17:81096453-81096475 17:81096480-81096502
Sequence CCTGGAGGCGCACCCCAGCATCC CAGTTCCCTGCGGGAGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 175} {0: 1, 1: 0, 2: 3, 3: 19, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!