ID: 1152565005_1152565019

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1152565005 1152565019
Species Human (GRCh38) Human (GRCh38)
Location 17:81096453-81096475 17:81096485-81096507
Sequence CCTGGAGGCGCACCCCAGCATCC CCCTGCGGGAGGAGCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 175} {0: 1, 1: 1, 2: 6, 3: 72, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!