ID: 1152565511_1152565514

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1152565511 1152565514
Species Human (GRCh38) Human (GRCh38)
Location 17:81098596-81098618 17:81098619-81098641
Sequence CCTGGTGTGTTCAGAATCGGTAG CTGGATCTGGAAGCTCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88} {0: 1, 1: 0, 2: 1, 3: 7, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!