ID: 1152568577_1152568586

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1152568577 1152568586
Species Human (GRCh38) Human (GRCh38)
Location 17:81111349-81111371 17:81111376-81111398
Sequence CCTTCGGGTGTGTGTGCCTTTGG GACAGCCTTGTGGGGACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157} {0: 1, 1: 0, 2: 3, 3: 36, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!