|
Left Crispr |
Right Crispr |
| Crispr ID |
1152569181 |
1152569187 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:81114055-81114077
|
17:81114078-81114100
|
| Sequence |
CCTGGGTTCAAGCGATCCTCCCA |
CTTCAGCCCCCCATGGAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 374, 1: 6655, 2: 36299, 3: 120770, 4: 247167} |
{0: 1, 1: 4, 2: 301, 3: 9943, 4: 131373} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|