ID: 1152569403_1152569411

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1152569403 1152569411
Species Human (GRCh38) Human (GRCh38)
Location 17:81115137-81115159 17:81115160-81115182
Sequence CCCGGGGATATGGGGGAGGGCGC GGCACCCCTCGGGGGACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 180} {0: 1, 1: 0, 2: 0, 3: 20, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!