ID: 1152574783_1152574786

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1152574783 1152574786
Species Human (GRCh38) Human (GRCh38)
Location 17:81135231-81135253 17:81135245-81135267
Sequence CCCGGCTTCCAAATCAGGACACC CAGGACACCTGAGCTGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 209} {0: 1, 1: 0, 2: 4, 3: 36, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!