|
Left Crispr |
Right Crispr |
| Crispr ID |
1152577181 |
1152577192 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:81147611-81147633
|
17:81147661-81147683
|
| Sequence |
CCAGGCATAGTGGCACACACCTG |
TCGGAGGATCGCTTAAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 146, 1: 2958, 2: 22243, 3: 77784, 4: 165140} |
{0: 2, 1: 221, 2: 5459, 3: 35010, 4: 90671} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|