ID: 1152587162_1152587168

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1152587162 1152587168
Species Human (GRCh38) Human (GRCh38)
Location 17:81194252-81194274 17:81194272-81194294
Sequence CCAACCCGAAGCACAGCTGAGTC GTCTTGACGCCCACGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 138, 4: 404} {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!